1. Immunology and Inflammation

Analysis of combinatorial chemokine receptor expression dynamics using multi-receptor reporter mice

  1. Laura Medina-Ruiz  Is a corresponding author
  2. Robin Bartolini
  3. Gillian J Wilson
  4. Douglas P Dyer
  5. Francesca Vidler
  6. Catherine E Hughes
  7. Fabian Schuette
  8. Samantha Love
  9. Marieke Pingen
  10. Alan James Hayes
  11. Jun Fu
  12. Adrian Francis Stewart
  13. Gerard J Graham  Is a corresponding author
  1. Chemokine Research Group, Institute of Infection, Immunity and Inflammation, College of Medical, Veterinary and Life Sciences, University of Glasgow, United Kingdom
  2. Center for Molecular and Cellular Bioengineering, Biotechnology Center, Technische Universität Dresden, Germany
  3. Shandong University–Helmholtz Institute of Biotechnology, State Key Laboratory of Microbial Technology, School of Life Science, Shandong University, China
  4. Max-Planck-Institute for Cell Biology and Genetics, Germany
https://doi.org/10.7554/eLife.72418
Share this article
Cite this article
  1. Laura Medina-Ruiz
  2. Robin Bartolini
  3. Gillian J Wilson
  4. Douglas P Dyer
  5. Francesca Vidler
  6. Catherine E Hughes
  7. Fabian Schuette
  8. Samantha Love
  9. Marieke Pingen
  10. Alan James Hayes
  11. Jun Fu
  12. Adrian Francis Stewart
  13. Gerard J Graham
(2022)
Analysis of combinatorial chemokine receptor expression dynamics using multi-receptor reporter mice
eLife 11:e72418.
https://doi.org/10.7554/eLife.72418
  2. Download BibTeX
  3. Download .RIS
10 figures, 1 video, 2 tables and 1 additional file

Figures

Figure 1 with 3 supplements
Download asset Open asset
Generation of the reporter mice.

(A) Reporters were selected for this study based on their discrete excitation and emission spectra. (B) (i) The inflammatory Ccr genes were targeted in a bacterial artificial chromosome (BAC). (ii) The coding sequence of each inflammatory Ccr was replaced with a different fluorescent reporter (ii). (iii) Pro-nuclear injection was then used to generate the transgenic reporter mice. (C) (i) The inflammatory Ccr gene-REP cluster inserted into chromosome 16 (red circle), as determined by targeted locus amplification (TLA). The blue circle represents the endogenous locus. (ii) The insertion site does not contain any other genes or regulatory regions. (D) Leukocyte counts determined by flow cytometry in the inflamed air-pouch. Data are shown for (i) the membrane that surrounds the air-pouch and for (ii) the lavage fluid. (E) Leukocyte counts determined by flow cytometry in PBS- or LPS-treted lungs. Data on D and E are shown as mean ± SEM and are compiled from at least two separate experiments. Normally distributed data were analysed using unpaired t-test with or without Welch’s correction, according to their standard deviations. Not normally distributed data were analysed using Mann-Whitney or Kolmogorov-Smirnov, according to their standard deviations. Each data point represents a measurement from a single mouse (N=15-18 in D; N=4-6 in E). Abbreviations are: Monos, monocytes; Macs, macrophages; Neu, neutrophils; Eos, eosinophils; DCs, dendritic cells; Alv macs, alveolar macrophages. See also Figure 1—figure supplement 3.

Figure 1—figure supplement 1
Download asset Open asset
Gating strategies used in the study.

Gating strategies used for the isolation of cell subsets in (A) spleen, (B) bone marrow and blood, and (C) air-pouch membrane. Abbreviations are: Eϕ, eosinophils; Nϕ, neutrophils; Mϕ, macrophages.

Figure 1—figure supplement 2
Download asset Open asset
Gating strategies used in the study.

Gating strategies used for the isolation of (A) lung and (B) kidney cell subsets. Abbreviations are: Nϕ, neutrophils; Eϕ, eosinophils; Alv Mϕ, alveolar macrophages; Mϕ, macrophages; moDCs, monocyte-derived dendritic cells.

Figure 1—figure supplement 3
Download asset Open asset
Normal leukocyte recruitment in the reporter mice.

Leukocyte counts determined by flow cytometry in resting (i) bone marrow, (ii) lung, (iii) blood, (iv) spleen, and (v) kidney. Data are shown as mean ± SEM and are compiled from at least two separate experiments. Normally distributed data were analysed using unpaired t-test with or without Welch’s correction, according to their standard deviations. Not normally distributed data were analysed using Mann-Whitney or Kolmogorov-Smirnov, according to their standard deviations. Each data point represents a measurement from a single mouse (N=7-14). Abbreviations are: Monos, monocytes; Macs, macrophages; Neu, neutrophils; Eos, eosinophils; DCs, dendritic cells; RPMacs, red pulp macrophages; Alv macs, alveolar macrophages.

Figure 2
Download asset Open asset
Inflammatory CC chemokine receptor (iCCR) reporter expression accurately mirrors iCCR surface presentation.

(A) (i) Flow cytometric analysis of CCR2 antibody binding and mRuby2 expression in spleen Ly6Chi monocytes at rest. (ii) Quantification of the percentage of Ly6Chi monocytes binding CCR2 antibody and expressing mRuby2. (B) (i) Flow cytometric analysis of CCR3 antibody binding and mTagBFP2 expression in spleen SiglecF+ eosinophils at rest. (ii) Quantification of the percentage of SiglecF+ eosinophils binding CCR3 antibody and expressing mTagBFP2. (C) (i) Flow cytometric analysis of CCR5 antibody binding and iRFP682 expression in kidney CD11b+F4/80+ macrophages at rest. (ii) Quantification of the percentage of CD11b+F4/80+ macrophages binding CCR5 antibody and expressing iRFP682. (D) (i) Flow cytometric analysis of Clover expression in kidney CD11b+F4/80+ macrophages at rest. (ii) Quantification of the percentage of CD11b+F4/80+ macrophages expressing Clover. (iii) Brightfield images of resting kidneys showing CCR1 mRNA molecules detected by RNAscope analysis in the form of red precipitate dots (arrows). (iv) CCR1 mRNA molecule counts per field of view. Data information: data on Aii, Bii, Cii, Dii, and Div are shown as mean ± SD and are compiled from at least two separate experiments (N=4-7 in A, B and C: N=2-3 in D).

Figure 3
Download asset Open asset
Inflammatory CC chemokine receptor (iCCR) expression in bone marrow and blood leukocytes at rest.

(A) Flow cytometric analysis of Clover/CCR1 and mRuby2/CCR2 expression in (i) bone marrow and (iii) circulating Ly6Chi monocytes. Quantification of the percentage of Ly6Chi monocytes expressing the fluorescent reporters in (ii) bone marrow and (iv) blood. (v) Flow cytometric analysis of Clover/CCR1 and mRuby2/CCR2 co-expression in bone marrow and circulating Ly6Chi monocytes. Distribution of Clover and mRuby2 in (vi) bone marrow and (vii) circulating Ly6Chi monocytes. (B) (i) Flow cytometric analysis of mTagBFP2/CCR3 expression in bone marrow and circulating SiglecF+ eosinophils. Quantification of the percentage of SiglecF+ eosinophils expressing the iCCR reporters in (ii) bone marrow and (iii) blood. Data on A–B are compiled from at least three separate experiments. Data on Aii, Aiv, Bii, and Biii are shown as mean ± SEM (N=10). Each data point represents a measurement from a single mouse. Blots in Ai, Aiii, and Bi are combinatorial blots showing reporter expression in iCCR-REP and wild type (WT) (control for background autofluorescence) mice.

Figure 4 with 4 supplements
Download asset Open asset
Inflammatory CC chemokine receptor (iCCR) expression in resting lung.

(A) (i) Flow cytometric analysis of mRuby2/CCR2 expression in Ly6Chi monocytes. (ii) Quantification of the percentage of Ly6Chi monocytes expressing the iCCR reporters. (iii) Distribution of the iCCR reporters in Ly6Chi monocytes. (B) Flow cytometric analysis of (i) Clover/CCR1, (ii) mRuby2/CCR2, and (iii) iRFP682/CCR5 expression in F4/80+ macrophages. (iv) Quantification of the percentage of F4/80+ macrophages expressing the iCCR reporters. (v) Distribution of the iCCR reporters in F4/80+ macrophages. (vi) mRuby2/CCR2 mean fluorescence intensity from Ly6Chi monocytes and F4/80+ macrophages. (vii) Lung leukocytes expressing CCR2 exclusively (white arrow), CCR1 and CCR5 (chevron) or CCR5 exclusively (yellow arrow). Data in A–B are compiled from at least two separate experiments. Data on Aii, Biv, Bvi are shown as mean ± SEM (N=10). Each data point represents a measurement from a single mouse. Blots in Ai, Bi, Bii, and Biii are combinatorial blots showing reporter expression in iCCR-REP and wild type (WT) (control for background autofluorescence) mice. Data on Bvi were analysed using unpaired t-test. **p<0.01. See also Figure 4—figure supplement 2 and , Figure 4—figure supplement 4.

Figure 4—figure supplement 1
Download asset Open asset
Reporter co-expression in resting tissues.
Figure 4—figure supplement 2
Download asset Open asset
Inflammatory CC chemokine receptor (iCCR) expression in resting lung.

(A) Flow cytometric analysis of (i) Clover/CCR1, (ii) mRuby2/CCR2, and (iii) iRFP682/CCR5 expression in F4/80Lo monocyte-derived dendritic cells (moDCs) in resting lung. (iv) Quantification of the percentage of F4/80Lo moDCs expressing the iCCR reporters. (B) Flow cytometric analysis of (i) Clover/CCR1, (ii) mRuby2/CCR2, and (iii) iRFP682/CCR5 expression on F4/80+ moDCs in resting lung. (iv) Quantification of the percentage of F4/80+ moDCs expressing the iCCR reporters. (C) Flow cytometric analysis of the co-expression of (i) Clover/CCR1 with mRuby2/CCR2 or (ii) iRFP682/CCR5 with mRuby2/CCR2 on moDCs in resting lung. Distribution of the iCCR reporters in (iii) F4/80Lo and (iv) F4/80+ moDCs. (D) Flow cytometric analysis (i) and quantification (ii) of iCCR expression on bone marrow (BM)-derived GM-CSF moDCs. (E) (i) Flow cytometric analysis of mTagBFP2/CCR3 expression in SiglecF+ eosinophils in resting lung. (ii) Quantification of the percentage of SiglecF+ eosinophils expressing the iCCR reporters. Data in A–C and E are compiled from at least three separate experiments. Data in Dii is pooled from five mice and shown as mean ± SD. Data in Aiv, Biv, and Eii are shown as mean ± SEM (N=10). Each data point represents a measurement from a single mouse. Blots in Ai, Aii, Aiii, Bi, Bii, Biii, and Ei are combinatorial blots showing reporter expression in iCCR-REP and wild type (WT) (control for background autofluorescence) mice.

Figure 4—figure supplement 3
Download asset Open asset
Inflammatory CC chemokine receptor (iCCR) expression in monocytes and macrophages during differentiation.

(A) Schematic of the procedure used to transfer monocytes into the air-pouch. (B) iCCR expression on REP Ly6CHi monocytes immediately before injection into the air-pouch. (C) iCCR expression on F4/80+ macrophages in air-pouch 3 days after REP monocyte transfer. (i) Flow cytometric analysis of Clover/CCR1, mRuby2/CCR2, and iRFP682/CCR5. (ii) Abundance of REP macrophages in the air-pouch. (iii) Co-expression of iCCR reporters on REP macrophages. Data in Cii are shown as mean ± SEM (N=3-6).

Figure 4—figure supplement 4
Download asset Open asset
Inflammatory CC chemokine receptor (iCCR) reporters are readily visualised in tissues.

Spleens from resting mice were isolated and imaged using an AxioImager M2 microscope (Zeiss). Different magnifications are shown.

Figure 5 with 2 supplements
Download asset Open asset
Inflammatory CC chemokine receptor (iCCR) expression in resting kidney.

(A) (i) Flow cytometric analysis of mRuby2/CCR2 expression in Ly6Chi monocytes. (ii) Quantification of the percentage of Ly6Chi monocytes expressing the iCCR reporters. (iii) Distribution of the iCCR reporters in Ly6Chi monocytes. (B) Flow cytometric analysis of (i) Clover/CCR1, (ii) mRuby2/CCR2, and (iii) iRFP682/CCR5 expression on F4/80+ macrophages. (iv) Quantification of the percentage of F4/80+ macrophages expressing the iCCR reporters. (v) Distribution of the iCCR reporters in F4/80+ macrophages. (vi) mRuby2/CCR2 mean fluorescence intensity from Ly6Chi monocytes and F4/80+ macrophages. (vii) Kidney leukocytes expressing CCR1 exclusively (white arrow), CCR5 exclusively (yellow arrow) or CCR1 and CCR5 (green arrow). Data in A–B are compiled from at least two separate experiments. Data on Cii, Civ, and Cvi are shown as mean ± SEM (N=7). Each data point represents a measurement from a single mouse. Blots in Ai, Bi, Bii, and Biii are combinatorial blots showing reporter expression in iCCR-REP and wild type (WT) (control for background autofluorescence) mice. Data on Bvi were analysed using unpaired t-test with Welch’s correction. **p<0.01. See also Figure 5—figure supplement 1 and Figure 5—figure supplement 2.

Figure 5—figure supplement 1
Download asset Open asset
Reporter co-expression in resting tissues.
Figure 5—figure supplement 2
Download asset Open asset
Inflammatory CC chemokine receptor (iCCR) reporters visualised in resting kidney.

Kidneys from resting mice were isolated and imaged using an AxioImager M2 microscope (Zeiss). Inlet shows a myeloid cell co-expressing Clover/CCR1 and iRFP682/CCR5.

Figure 6
Download asset Open asset
Inflammatory CC chemokine receptor (iCCR) expression in acutely inflamed bone marrow and blood leukocytes.

(A) Schematic of the procedure used to induce acute inflammation using the air-pouch model. (B) Flow cytometric analysis of Clover/CCR1 and mRuby2/CCR2 expression in (i) bone marrow and (iv) circulating Ly6Chi monocytes. Quantification of the percentage of (ii) bone marrow and (v) circulating Ly6Chi monocytes expressing the iCCR reporters. Quantification of the fold change increase in CCR1 and CCR2 expression by (iii) bone marrow and (vi) circulating Ly6Chi monocytes after induction of inflammation. (C) (i) Flow cytometric analysis and distribution of Clover/CCR1 and mRuby2/CCR2 in (ii) bone marrow and (iii) circulating Ly6Chi monocytes in the air-pouch model. (D) (i) Flow cytometric analysis of mTagBFP2/CCR3 expression in bone marrow and circulating SiglecF+ eosinophils. Quantification of the percentage of SiglecF+ eosinophils expressing the iCCR reporters in (ii) bone marrow and (iii) blood. Data on Bii, Biii, Bv, Bvi, Dii, and Diii are shown as mean ± SEM (N=10 for resting mice or N=15 for carrageenan-treated mice) and are compiled from at least three separate experiments. Each data point represents a measurement from a single mouse. Blots in Bi, Biv, and Di are combinatorial blots showing reporter expression in iCCR-REP and wild type (WT) (control for background autofluorescence) mice. Normally distributed data on Biii and Bvi were analysed using unpaired t-test with or without Welch’s correction, according to their standard deviations. Not normally distributed data were analysed using Mann-Whitney or Kolmogorov-Smirnov, according to the standard deviations. *p<0.05; **p<0.01; ****p<0.0001.

Figure 7
Download asset Open asset
Inflammatory CC chemokine receptor (iCCR) expression in bone marrow and blood under sustained inflammation.

(A) Schematic of the procedure used to induce sustained inflammation using interferon gamma (IFNγ) release from osmotic pumps. (B) Flow cytometric analysis of Clover/CCR1 expression in (i) bone marrow and (iv) circulating Ly6Chi monocytes. Quantification of the fold change increase in CCR1+ and CCR2+ cells in (ii) bone marrow and (v) circulating Ly6Chi monocytes after the induction of sustained inflammation. Mean fluorescence intensity of Clover/CCR1 expression in (iii) bone marrow and (vi) circulating CCR1+ Ly6 Chi monocytes. (C) Flow cytometric analysis and distribution of Clover/CCR1 and mRuby2/CCR2 in (i and ii) bone marrow and (iii and iv) circulating Ly6Chi monocytes. Data on B–C are compiled from at least two separate experiments. Data on Bii, Biii, Bv, and Bvi are shown as mean ± SEM (N=3-5). Each data point represents a measurement from a single mouse. Plots in Bi and Biv are combinatorial plots showing reporter expression in iCCR REP and wild type (WT) (control for background autofluorescence) mice. Normally distributed data were analysed using unpaired t-test with or without Welch’s correction, according to their standard deviations. Not normally distributed data were analysed using Mann-Whitney or Kolmogorov-Smirnov, according to the standard deviations. *p<0.05; ns, not significant.

Figure 8 with 2 supplements
Download asset Open asset
Inflammatory CC chemokine receptor (iCCR) expression in inflamed tissues: the air-pouch model.

(A) Flow cytometric analysis of Clover/CCR1, mRuby2/CCR2, and iRFP682/CCR5 expression in (i) Ly6Chi monocytes and (iii) F4/80+ macrophages isolated from the inflamed air-pouch. Quantification of iCCR reporter expression in (ii) Ly6Chi monocytes and (iv) F4/80+ macrophages. (B) (i) Flow cytometric analysis of mTagBFP2/CCR3 expression in SiglecF+ eosinophils isolated from the inflamed air-pouch. (ii) Quantification of iCCR reporter expression in SiglecF+ eosinophils. Data on Aii, Aiv, and Bii are shown as mean ± SEM (N=15) and are compiled from at least three separate experiments. Each data point represents a measurement from a single mouse. Blots in Ai, Aiii, and Bi are combinatorial blots showing reporter expression in iCCR-REP and wild type (WT) (control for background autofluorescence) mice.

Figure 8—figure supplement 1
Download asset Open asset
Reporter co-expression in inflamed air-pouch.
Figure 8—figure supplement 2
Download asset Open asset
Inflammatory CC chemokine receptor (iCCR) expression in inflamed air-pouch: lymphoid cells.

(A) Flow cytometric analysis of (i) mRuby2/CCR2 and (ii) iRFP682/CCR5 expression in CD11b- NK cells. (iii) Quantification of the percentage of CD11b- NK cells expressing the iCCR reporters. (iv) Distribution of the iCCR reporters in CD11b- NK cells. (B) Flow cytometric analysis of (i) mRuby2/CCR2 and (ii) iRFP682/CCR5 expression in CD11b+ NK cells. (iii) Quantification of the percentage of CD11b+ NK cells expressing the iCCR reporters. (iv) Distribution of the iCCR reporters in CD11b+ NK cells. (C) Flow cytometric analysis of (i) mRuby2/CCR2 and (ii) iRFP682/CCR5 expression in NKT cells. (iii) Quantification of the percentage of NKT cells expressing the iCCR reporters. (D) Flow cytometric analysis of (i) mRuby2/CCR2 in ab T cells. (iii) Quantification of the percentage of ab T cells expressing the iCCR reporters. (E) Flow cytometric analysis of (i) mRuby2/CCR2 in gd T cells. (iii) Quantification of the percentage of gd T cells expressing the iCCR reporters. Data in A–E are compiled from at least three separate experiments. Data on Aiii, Biii, Ciii, Dii, and Eii are shown as mean ± SEM (N=10-15). Each data point represents a measurement from a single mouse. Plots in Ai, Aii, Bi, Bii, Ci, Cii, Di, and Ei are combinatorial plots showing reporter expression in iCCR-REP and wild type (WT) (control for background autofluorescence) mice.

Figure 9 with 2 supplements
Download asset Open asset
Inflammatory CC chemokine receptor (iCCR) expression in inflamed tissues: the intranasal lipopolysaccharide (LPS) model.

(A) (i) Schematic of the procedure used to induce acute lung inflammation using intranasal administration of LPS. (ii) Quantification of monocyte, macrophage, alveolar macrophage, and eosinophil levels in inflamed lungs. Quantification of iCCR reporter expression in (iii) Ly6Chi monocytes and (iv) F4/80+ macrophages isolated from lungs of vehicle (PBS) and LPS-treated mice. (B) Distribution of Clover/CCR1, mRuby2/CCR2, and iRFP682/CCR5 on Ly6Chi monocytes isolated from lungs of (i) vehicle (PBS) and (ii) LPS-treated mice. (C) Distribution of Clover/CCR1, mRuby2/CCR2, and iRFP682/CCR5 on F4/80+ macrophages isolated from lungs of (i) vehicle (PBS) and (ii) LPS-treated mice. (D) Quantification of iCCR reporter expression on (i) SiglecF+ eosinophils and (ii) SiglecF+ F4/80+ alveolar macrophages isolated from lungs of vehicle and LPS-treated mice. Data in A–D are compiled from at least two separate experiments. Data on Aii, Aiii, Aiv, Di, and Dii are shown as mean ± SEM (N=7 for vehicle-treated mice or N=6 for LPS-treated mice). Each data point represents a measurement from a single mouse. Data on Aii were analysed using unpaired t-test, with the exception of alveolar macrophage, which was analysed using Mann-Whitney test. **p<0.01; ****p<0.0001. Abbreviations are: Monos, monocytes; Macs, macrophages; Alv Macs, alveolar macrophages; Eos, eosinophils.

Figure 9—figure supplement 1
Download asset Open asset
Inflammatory CC chemokine receptor (iCCR) reporters visualised in resting and inflamed lungs.

Lungs from PBS- (A) or LPS- (B) treated mice were isolated and imaged using an AxioImager M2 microscope (Zeiss).

Figure 9—figure supplement 2
Download asset Open asset
Reporter co-expression in inflamed lung.
Figure 10
Download asset Open asset
Proposed model for the contribution of the inflammatory CC chemokine receptors (iCCRs) to leukocyte migration.

Videos

Video 1
Download asset
Real-time in vivo imaging of iCCR reporters in resting mammary gland.

Tables

Table 1
Primers used in the study.
A. Detection of the iCCR reporters
iRFP682 QPCR1GTCACCCCAGACCTCAATCC
iRFP682 QPCR2AACGATCAATCCCCACAGTC
mRuby2 RT FTGGGAAAGAGTTACGAGATACGA
mRuby2 RT RAACGAGACAGCCATCCTCAA
Clover QPCR1AACGGCATCAAGGCTAACTTC
Clover QPCR2GGGTGTTCTGCTGGTAGTGG
mTagBFP2 QPCR1ACCGTGGACAACCATCACTT
mTagBFP2 QPCR2CCTCGACCACCTTGATTCTC
B. Quantification of iCCR-REP cluster insertion
CCR1prom QPCR1TCAACTCAACTCCATCCAACC
CCR1prom QPCR2CTGTCTTTCCTCTCTGCTCCA
BAC-CPN1 Stan1CAGCTAGCCCCCAGGTGACA
BAC-CPN1 Stan2AGTCTTTCTTTCCTGCGTTGTATG
BAC-CPN1 QPCR1GATAAAGGGAAGCAGACACCAG
BAC-CPN1 QPCR2CAGCAGGGAGGAAAGAAGAGT
BAC-CPN2 Stan1AGTCTTTCTTTCCTGCGTTGTATG
BAC-CPN2 Stan2AAAACCAGACAGGATAGATAACTG
BAC-CPN2 QPCR1AGGGGTGGAAGCCTATCTCTAC
BAC-CPN2 QPCR2TGGCAGCATTTACAGGGTCT
BAC-CPN3 Stan1GGATGGGAGGGAATTTGGAGAAGA
BAC-CPN3 Stan2GCTTTGTGAAGGCCGAGGTCTAA
BAC-CPN3 QPCR1CCCCATCCATAACACAAACC
BAC-CPN3 QPCR2CAAAATGAGCACCTCCCTTC
CCR2exon Stan1AGGGAGAGCAGAAGGCTAA
CCR2exon Stan2CCCAGGAAGAGGTTGAGAGA
CCR2exon QPCR1TGTGGGACAGAGGAAGTGG
CCR2exon QPCR2GGAGGCAGAAAATAGCAGCA
CCR5exon Stan1ACCCATTGAGGAAACAGCAA
CCR5exon Stan2CTTCTGAGGGGCACAACAAC
CCR5exon QPCR1TTTGTTCCTGCCTTCAGACC
CCR5exon QPCR2TTGGTGCTCTTTCCTCATCTC
TBP Stan1GAGTTGCTTGCTCTGTGCTG
TBP Stan2ATACTGGGAAGGCGGAATGT
TBP QPCR1TGCTGTTGGTGATTGTTGGT
TBP QPCR2AACTGGCTTGTGTGGGAAAG
Table 2
Antibodies used in the study.
AntibodyCloneSourceWorking dilution
Anti-mouse CD4530-F11eBioscience1/100
Anti-mouse CD11bM1/70eBioscience1/100
Anti-mouse SiglecFE50-2440BD Bioscience1/100
Anti-mouse F4/80BM8eBioscience1/100
Anti-mouse CD64X54-5/7.1BD Bioscience1/100
Anti-mouse Ly6CHK1.4BioLegend1/100
Anti-mouse CD11cHL3BD Bioscience1/100
Anti-mouse MHCIIM5/114.15.2BioLegend1/100
Anti-mouse Ly6G1A8BD Bioscience1/100
Anti-mouse CD19eBio1D3 (1D3)eBioscience1/100
Anti-mouse CCR2SA203G11BioLegend1/50
Anti-mouse CCR3J073E5BioLegend1/50
Anti-mouse CCR5HM-CCR5 (7A4)eBioscience1/50

Additional files

Transparent reporting form
https://cdn.elifesciences.org/articles/72418/elife-72418-transrepform1-v2.docx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Laura Medina-Ruiz
  2. Robin Bartolini
  3. Gillian J Wilson
  4. Douglas P Dyer
  5. Francesca Vidler
  6. Catherine E Hughes
  7. Fabian Schuette
  8. Samantha Love
  9. Marieke Pingen
  10. Alan James Hayes
  11. Jun Fu
  12. Adrian Francis Stewart
  13. Gerard J Graham
(2022)
Analysis of combinatorial chemokine receptor expression dynamics using multi-receptor reporter mice
eLife 11:e72418.
https://doi.org/10.7554/eLife.72418